Indice Anterior Siguiente
Formato PDF

Nociones de bioquímica y genética útiles para los profesionales de la información del sector de la salud

Lic. Rubén Cañedo Andalia1 y Dr. Julio C. Guerrero Pupo2

Resumen

Con el objetivo de contribuir a la creación de una cultura básica sobre ciertos temas esenciales para la labor de los profesionales de la información en los nuevos entornos de la medicina moderna, se tratan algunos conceptos y definiciones esenciales útiles para comprender los avances de la bioquímica y la genética modernas. La introducción de estas nociones en el vocabulario de uso frecuente de estos profesionales facilitará su acercamiento al entorno genómico de la nueva medicina clínica.

Palabras clave: Genética, bioquímica, ADN, ARN, información genética, proteínas, código genético.

Abstract

Some essential concepts and definitions that are useful to understand the advances of modern biochemistry and genetics are dealt with aimed at contributing to the creation of a basic culture on certain fundamental topics for the work of information professionals in the new modern medicine settings. The introduction of these notions into the daily vocabulary of these professionals will make possible their approximation to the genomic environment of the new clinical medicine.

Key words: Genetic, Biochemistry, DNA, RNA, genetic information, proteins, genetic code.

Copyright: © ECIMED. Contribución de acceso abierto, distribuida bajo los términos de la Licencia Creative Commons Reconocimiento-No Comercial-Compartir Igual 2.0, que permite consultar, reproducir, distribuir, comunicar públicamente y utilizar los resultados del trabajo en la práctica, así como todos sus derivados, sin propósitos comerciales y con licencia idéntica, siempre que se cite adecuadamente el autor o los autores y su fuente original.

Cita (Vancouver): Cañedo Andalia R. Nociones de bioquímica y genética útiles para los profesionales de la información del sector de la salud. Acimed 2005;13(1). Disponible en: http://bvs.sld.cu/revistas/aci/vol13_1_05/aci05105.htm Consultado: día/mes/año.

Los avances experimentados por la genética durante los últimos años han abierto el camino al nacimiento de una medicina basada en la genómica. Ella constituye, sin dudas, un nuevo espacio profesional para los bibliotecarios de la salud, tanto de la esfera de las ciencias básicas como de la clínica.

Sin embargo, los profesionales de la información y la informática que laboran en el sector de la salud carecen del conocimiento necesario en materia de biociencias moleculares como para actuar en los amplios escenarios que ofrecería una medicina basada en la genómica. Sin la suficiente instrucción, un bibliotecario o un informático médico podría participar sólo de forma marginal en el desarrollo de esta nueva área del conocimiento.

Con la presente contribución, se pretende introducir a los especialistas interesados en un área del conocimiento frecuentemente relegada: las ciencias básicas, pero cuyas posibilidades de desarrollo en materia profesional para nuestros profesionales son inmensas en un futuro cercano.

Como es lógico, los temas sólo pueden abordarse de forma superficial y sin tratar de abarcar la totalidad de los nuevos conceptos manejados en el mundo de la genómica y la bioinformática, sino sólo aquella parte que resulta relevante para los especialistas en información en el sector de la salud; por ello, no se abarcará el área de los algoritmos y los cálculos.

A continuación se abordarán con brevedad un conjunto de conceptos básicos útiles para adentrarse en el mundo de la bioinformática.

El ADN 1,2

ADN es la abreviatura del ácido desoxirribonucleico. Constituye el material genético de los organismos. Es el componente químico primario de los cromosomas y el material que forma los genes. El ADN es la molécula que controla todos los procesos celulares como la alimentación, la reproducción y la transmisión de caracteres de padres a hijos.

Una molécula es una partícula formada por un conjunto de átomos ligados por enlaces covalentes, de forma que permanecen unidos el tiempo suficiente como para completar un número considerable de vibraciones moleculares.

La química orgánica y gran parte de la química inorgánica se ocupan de la síntesis y reactividad de moléculas y compuestos moleculares.

En las bacterias y otros organismos unicelulares, el ADN está distribuido por la célula. En organismos más complejos como las plantas, los anímales y otros organismos multicelulares, la mayoría del ADN reside en el núcleo celular. Se conoce desde hace más de cien años. En 1868, Friedrich Miescher, un biólogo suizo, identificó el ADN en los núcleos de las células del pus,obtenidas de los vendajes quirúrgicos desechados y en la esperma del salmón. Le llamó a la sustancia nucleína.

En 1953, el descubrimiento de la estructura de la molécula de ADN (ácido desoxirribonucleico) por James Watson y Francis Crick dio origen a la biotecnología moderna. Por estudios anteriores, se sabía que el ADN almacena la información genética en todos los seres vivos. También se sabía que el ADN estaba formado por la combinación de unas moléculas más pequeñas llamadas nucleótidos. Los nucleótidos, a su vez, constan de un azúcar (la desoxirribosa), un fosfato y una de las cuatro bases siguientes: la adenina, guanina, citosina y timina o abreviadamente A, G, C, T.

Watson y Crick, a partir de estos y otros datos, descubrieron que la molécula de ADN está formada por dos largos filamentos -cada uno de ellos es una cadena de nucleótidos- que se enrollan entre sí para dar lugar a una doble hélice parecida a una escalera de caracol. La parte lateral o "barandilla" de la escalera está formada por azúcares (desoxirribosa) y fosfatos y los peldaños son pares de bases. En esta estructura, la adenina se empareja siempre con la timina (A-T, T-A) y la citosina se empareja con la guanina (C-G, G-C) y sólo se permiten estos emparejamientos. El tipo de nucleótidos y el orden -denominado secuencia- en que se disponen estas moléculas es la manera cómo se escribe la información genética, mediante una especie de alfabeto de 4 letras.

La molécula de ADN tiene la capacidad de desdoblarse, servir como molde y dar lugar a otra molécula idéntica, así es como pasa la información genética de padres a hijos. En general, una célula tiene una maquinaria muy sofisticada que permite hacer copias muy precisas de la molécula de ADN, incluso existen diversos sistemas de reparación. No obstante, en ocasiones se producen fallos. Cuando esto ocurre, se dice que ocurrido una mutación -es decir, un error genético- y si es suficientemente importante, puede llegar a cambiar la información que se transmite a la molécula de ADN.

Estructura

Existen cuatro bases: dos púricas denominadas adenina (A) y guanina (G) y dos pirimidínicas, denominadas citosina (C) y timina (T). Para formar el ADN, se unen largas cadenas de estas bases mediante moléculas de fosfato y azúcar. La estructura de doble hélice del ADN no se descubrió hasta 1953 por James Watson y Francis Crick; ellos también, mostraron el modo en que el ADN se podía "desenrollar" para que fuera posible su lectura o copia.

Una larga hebra de ácido nucleico está enrollada alrededor de otra hebra y forma un par entrelazado. Dicha hélice mide 3,4 nm de paso de rosca y 2,37 nm de diámetro, y está formada, en cada vuelta, por 10,4 pares de nucleótidos enfrentados por sus bases nitrogenadas.

Si todo el ADN contenido en el núcleo de las células humanas se estirara llegaría a medir hasta 1,8 metros, es decir, unas 300 000 veces más que el diámetro del núcleo. Para evitar este problema, el ADN está altamente plegado formando unas estructuras denominadas cromosomas.

El genoma humano está constituido por 23 pares de cromosomas. Cada cromosoma es una única molécula de ADN que, a su vez, está formado por millares de nucleótidos. Si se escribiera en el alfabeto de 4 letras toda la información genética que contiene una célula humana, se llenaría un libro con más de 500 000 páginas.

Por lo tanto, las tres características que permiten a la molécula de ADN ser la depositaria de la información genética de un organismo son: que la molécula de ADN contiene información basada en el orden y composición de los nucleótidos que la forman; que es capaz de pasar esta información de generación en generación gracias a que cada cadena puede servir como molde para fabricar su complementaria; y que es flexible, lo que permite que pueda almacenarse toda la información que requiere un ser vivo para ser como es y realizar sus funciones en un espacio tan pequeño como el interior de las células.

El rasgo fundamental es que las bases de nucleótidos de una hebra "casan" con la especie de nucleótidos de la otra, en el sentido de que la adenina siempre casa con la timina (lo que se denomina A....T) y la guanina siempre casa con la citosina (G...C) (figura 1)

Este emparejamiento corresponde a la observación realizada por Erwin Chargaff, (1905-2002) de que en todas las muestras, la cantidad de adenina es siempre la misma que la de timina, como ocurre con la guanina y la citosina, así se aseguran cantidades iguales. Así, una pequeña purina (adenina y guanina) siempre se empareja con una pirimidina (timina y citosina) mayor, así se hace uniforme la doble hélice. La cantidad de purina (A+G) es siempre igual a la cantidad de primidina (T+C). Se estima que el genoma humano tiene alrededor de 3.000 millones de pares de bases. Dos unidades de medida muy utilizadas son la kilobase (kb) que equivale a 1.000 pares de bases, y la megabase (Mb) que equivale a un millón de pares de bases

 

Fig. 1. Estructura del ADN.

El modelo de doble hélice permite explicar las propiedades que se esperan del ADN:

Enlace de hidrógeno

La adhesión de las dos hebras de ácido nucleico se debe a un tipo especial de unión química conocido como puente de hidrógeno. Los puentes de hidrógeno son uniones más débiles que los típicos enlaces químicos, esto significa que las dos hebras de la hélice pueden separarse con facilidad, quedando intactas.

Función de la secuencia

En un gen, la secuencia de los nucleótidos, a lo largo de la cadena de ADN, define la proteína que un organismo es capaz de sintetizar o "expresar" en uno o varios momentos de su vida, a partir de la información de dicha secuencia. La relación entre la secuencia de nucleótidos y la secuencia de aminoácidos de la proteína es determinada por un mecanismo celular de traslación, conocido de forma general, como código genético.

En muchas especies de organismos, sólo una pequeña fracción del total de la secuencia del genoma codifica proteínas. La función del resto es especulativa.
La secuencia también determina la susceptibilidad del ADN para ser cortado por restricción enzimática, la quintaesencia de la ingeniería genética. La posición en la que se secuencia en un genoma individual determina la huella de ADN.

EL ADN como almacén de información 2

En realidad se puede considerar así, un almacén de información (mensaje) que se trasmite de generación en generación, con toda la información necesaria para construir y sostener el organismo en el que habita.

El ADN es el archivo genético en el que están impresas las instrucciones que necesita un ser vivo para nacer y desarrollarse a partir de la primera célula.

Se puede considerar que las obreras de este mecanismo son las proteínas. Estas pueden ser estructurales como las proteínas de los músculos, cartílagos, pelo, etc., o bien funcionales como las de la hemoglobina o las de innumerables enzimas del organismo. La función principal de la herencia es la especificación de las proteínas, el ADN es una especie de plano o receta para nuestras proteínas. Unas veces la modificación del ADN que provoca disfunción proteica se le llamamos enfermedad, otras veces, en sentido beneficioso, dará lugar a lo que se conoce como evolución.

Las alrededor de treinta mil proteínas diferentes en el cuerpo humano están hechas de veinte aminoácidos diferentes, y una molécula de ADN debe especificar la secuencia en que se unen dichos aminoácidos,

El ADN en el genoma de un organismo podría dividirse conceptualmente en dos, el que codifica las proteínas y el que no codifica. En el proceso de elaborar una proteína, el ADN de un gen se lee y se transcribe a ARN. Este ARN sirve como mensajero entre el ADN y la maquinaria que elaborará las proteínas y por eso recibe el nombre de ARN mensajero. El ARN mensajero instruye a la maquinaria que elabora las proteínas, para que ensamble los aminoácidos en el orden preciso para armar la proteína.

El dogma central de la genética es que el flujo de actividad y de información es:
ADN ® ARN ® proteína.

Sólo muy raras veces la información fluye del ARN al ADN.

El ARN 2,3

Es el ácido ribonucleico.

El código genético de las células se encuentra en forma de ADN. Dentro de las moléculas de ADN, existe información para sintetizar las proteínas que utiliza el organismo; pero el proceso no es lineal, es bastante complicado. El ADN no se traduce directamente en proteínas.

En las células eucariotas, el ADN se encuentra encerrado en el núcleo. La síntesis se hace en el citoplasma, es decir , fuera del núcleo. El mecanismo por el que la información se trasvasa desde el núcleo celular al citoplasma es mediante la transcripción del ARN desde el ADN.

Parte del ADN se transcribe, es decir, se copia en el ARN. El ARN actúa como un mensajero que lleva la información hasta el citoplasma y allí el ribosoma traduce los genes a proteínas. Este ARN, que es capaz de llevar el mensaje o conjunto de instrucciones para la síntesis de proteínas desde el núcleo al citoplasma, se denomina ARN mensajero.

El ADN, por tanto, es la "copia maestra" de la información genética, que permanece en "reserva" dentro del núcleo. El ARN, en cambio, es la "copia de trabajo" de la información genética.

El ARN también es una macromolécula de ácido nucleico como el ADN, pero tiene propiedades bastante diferentes. En primer lugar, el ADN es una hélice doble, sin embargo el ARN casi siempre está formado por una única cadena. En segundo lugar, el ADN contiene en sus nucleótidos, el azúcar desoxirribosa (de ahí su nombre), el ARN contiene ribosa. En tercer lugar, el ADN tiene cuatro bases: glicina (G), adenina (A), citosina (C) y timina (T). El ARN tiene G, A y C, pero la timina (T) se sustituye por el uracilo (U).

El uracilo, aunque es muy diferente, puede formar puentes de hidrógeno con la adenina, lo mismo que la timina.

El porqué el ARN contiene uracilo en lugar de timina es un enigma del que nadie sabe la respuesta.

El ARN se transcribe a partir de una de las dos cadenas del ADN. En caso contrario, de una de las hélices saldría una proteína y de la otra algo totalmente diferente.

Por ejemplo, si en una de las cadenas de ADN hubiera: GATACA, en la otra debería haber: CTATGT.

Que sólo se transcriba una hélice no significa que siempre sea la misma a lo largo de todo el cromosoma. Puede transcribirse una hélice en un sitio y otra en otro.

En la traducción de codones a aminoácidos intervienen otras moléculas de ARN, las llamadas ARN de transferencia.

Las proteínas 4

Las proteínas (del griego Proteion, primero) son macromoléculas de peso molecular elevado, formadas por aminoácidos unidos por enlaces peptídicos. Pueden presentar una o varias cadenas. Son sustancias muy versátiles.

Las proteínas son biomoléculas formadas básicamente por carbono, hidrógeno, oxígeno y nitrógeno. Pueden además, contener azufre y en algunos tipos de proteínas, fósforo, hierro, magnesio y cobre, entre otros elementos. Una proteína se forma por la unión de más de 50 aminoácidos.

Las proteínas son las biomoléculas más abundantes. Constituyen más del 50 por ciento de las células y se forman en el ribosoma a partir de la información suministrada por los genes.

Existen muchas proteínas distintas -por ejemplo, la hemoglobina, la queratina del pelo y las uñas, el colágeno, hormonas como la insulina, los anticuerpos, enzimas, etc.-, pero todas ellas están formadas por la combinación de sólo 20 tipos de unas moléculas más pequeñas llamadas aminoácidos. Como en el caso del ADN, es la secuencia en la que se disponen dichos aminoácidos lo que diferencia una proteína de otra pero tan sólo por el hecho de que la secuencia específica de aminoácidos de una proteína es la que le confiere la forma que esta adopta en el espacio y que es absolutamente básica para su función. Cuando una proteína pierde su forma nativa se dice que se desnaturaliza y esta desnaturalización suele conllevar una pérdida de la actividad de la proteína.

Funciones

Activas.

- Catalizadores (enzimas).
- Reguladoras (enzimas alostéricas, hormonas).
- Transportadora de oxígeno (O2) (hemoglobina).
- Almacenadora (mioglobina).
- Nutrición (ovoalbúmina).
- Defensiva (inmunoglobulinas) y anticuerpos.
- Contráctil (miosina, actinas).
- Visual (rodopsina, iodopsina).
- Energéticas (proteínas del fotosistema II).

Pasivas.
- Estructural (colágeno, queratina).

Estructura

Presentan una disposición característica en condiciones ambientales determinadas; si se cambia la presión, temperatura, pH u otro parámetro, pierde su conformación y, por tanto, su función. La función depende de la conformación y ésta, a su vez, está determinada por la secuencia de aminoácidos.

En un único cromosoma, y por lo tanto en una única molécula de ADN, se encuentran alineados muchísimos genes. En general, se denomina gen al fragmento de ADN que lleva la información para sintetizar una proteína. Es importante resaltar que si bien el ADN es donde se almacena la información genética de un organismo, las proteínas son las que ejecutan dicha información porque son las moléculas esenciales para todos los aspectos de estructura y actividad celular.

Los aminoácidos 5

Un aminoácido es una molécula que contiene un grupo carboxilo (-COOH) y un grupo amino (NH2-) libres. Químicamente son muy variados. Algunos forman proteínas (proteicos), mientras otros nunca se encuentran en ellas. Todos los aminoácidos que componen proteínas presentan un carbono asimétrico denominado alfa.

En los seres humanos, algunos aminoácidos son esenciales -y, por tanto, deben ingerirse en la dieta): Val, Leu, Ile, Phe, Tyr, Met, Thr, Lys, Arg, His.

Existen aminoácidos que no se consideran proteicos; sin embargo, aparecen en algunas proteínas. Son derivados de otros aminoácidos, es decir, se incorporan a la proteína como aminoácidos proteicos, y, después de formarse la proteína, se modifican químicamente, como la hidroxiprolina.

Los aminoácidos no proteicos actúan como neurotransmisores, vitaminas, etcétera. Por ejemplo la beta-alanina.

Los aminoácidos que componen las proteínas son 20: alanina, arginina, asparagina, aspartato, cisteína, fenilalanina, glicina, glutamato, glutamina, histidina, isoleucina, leucina, lisina, metionina, prolina, serina, tirosina, treonina, triptófano y valina.
(URL: http://es.wikipedia.org/wiki/Amino%C3%A1cido)

El ARN mensajero 2,6

El ARN mensajero es el ácido ribonucleico que contiene la información genética procedente del ADN para la síntesis de proteínas, es decir, determina el orden en que se unirán los aminoácidos.

El ARN mensajero es un ácido nucleico monocatenario, al contrario que el ADN que es bicatenario.

Aunque todas las células de un organismo disponen de la información necesaria para realizar todas las funciones corporales, cada tipo de célula se especializa en realizar una función determinada. Así, las células de la piel realizan funciones distintas que las células del hígado. Esta diferencia reside en el tipo de proteínas presentes y necesarias en cada célula. Por lo tanto, cada tipo de célula se caracteriza por generar, es decir expresar, sólo algunos de los genes de los que dispone en su genoma. Cuando una célula necesita una proteína debe buscar la información para fabricarla en su ADN. En el caso de las células eucariotas, el ADN se encuentra en el núcleo de la célula, en cambio las proteínas se producen en otra parte de la célula llamada citoplasma.

Es preciso que la célula copie la información contenida en el ADN a una molécula que actúa como mensajero y que es capaz de viajar del núcleo al citoplasma. Esta molécula recibe el nombre de ARN mensajero (ARNm). El proceso de fabricar una molécula de ARNm a partir de las instrucciones de una molécula de ADN, se denomina transcripción. El ARN, como el ADN, está formado también por la repetición de 4 nucleótidos, los mismos que forman el ADN excepto que en lugar de la base timina (T), el ARN tiene uracilo (U). La molécula de ARN es una única cadena -en lugar de dos como el ADN- y contiene el azúcar ribosa en lugar de la desoxirribosa que forma el ADN. Estas características hacen la molécula de ARN más frágil que la molécula de ADN.

El ARNm sale del núcleo y se lee en los ribosomas donde se fabrica la proteína que la célula quería obtener. El proceso de fabricar una proteína siguiendo las instrucciones almacenadas en el ARNm se llama traducción porque se pasa de un lenguaje de 4 letras (los 4 nucleótidos) en que están "escritos" el ADN y el ARN al lenguaje de 20 letras (los 20 aminoácidos) en que están "escritas" las proteínas.

El dogma central de la biología dice que en los procesos celulares el flujo de información va de ADN a ARN y de ahí a proteínas. No obstante, este dogma tiene sus excepciones en los retrovirus. Este tipo de virus se caracteriza porque su información genética no está almacenada en una molécula de ADN sino en una molécula de ARN y para que estos virus puedan multiplicarse es necesario que su información genética pase de ARN a ADN. Para ello, necesitan una enzima especial, la transcriptasa inversa. Uno de los retrovirus más conocidos es el virus de la inmunodeficiencia humana (VIH) que causa el SIDA.

El proceso de fabricación de una proteína puede no finalizar con la formación de la cadena de aminoácidos y el plegamiento de la proteína en el espacio, sino que algunas proteínas se someten además a otras modificaciones como la glicosilación, consistente en la adición de azúcares.

La síntesis proteica 7

La síntesis de proteínas o traducción del ARNm es el proceso anabólico mediante el cual se forman las proteínas a partir de los aminoácidos. Es el paso siguiente a la transcripción del ADN a ARNm. Como existen 20 aminoácidos diferentes y sólo hay cuatro nucleótidos en el ARNm (Adenina, Uracilo, Citosina y Guanina), es evidente que la relación no puede ser de un aminoácido por cada nucleótido, ni tampoco por cada dos nucleótidos, porque los cuatro tomados de dos en dos, sólo dan dieciséis posibilidades. La colinearidad debe establecerse como mínimo entre cada aminoácido y tripletes de nucleótidos. Como hay sesenta y cuatro tripletes diferentes -combinación de cuatro elementos o nucleótidos tomados de tres en tres con repetición´-, es obvio que algunos aminoácidos deben corresponderse con varios tripletes diferentes. Los tripletes que codifican aminoácidos se denominan codones.

La síntesis de proteínas o traducción tiene lugar en los ribosomas del citoplasma celular. Los aminoácidos son transportados por el ARN de transferencia (ARNt), específico para cada uno de ellos, y llevados hasta el ARN mensajero (ARNm), dónde se aparean el codón de éste y el anticodón del ARN de transferencia, por complementariedad de bases, y de ésta forma, se sitúan en la posición que les corresponde. Una vez finalizada la síntesis de una proteína, el ARN mensajero queda libre y puede ser leído de nuevo. De hecho, es muy frecuente que antes de que finalice una proteína, comienza otra, por lo que, una misma molécula de ARN mensajero, puede utilizarse por varios ribosomas simultáneamente.

El ribosoma 8

Los ribosomas son orgánulos no membranosos sólo visibles al microscopio electrónico debido a su reducido tamaño - 29 nm. en célula procariota y 32 nm. en eucariota- que se encuentran en todas las células vivas (excepto en el espermatozoide). Su función es ensamblar proteínas a partir de la información genética que le llega del ADN, transcrita en forma de ARN mensajero (ARNm).

El ribosoma consta de dos sub-unidades que trabajan juntas para la traducción del ARNm en proteínas en el proceso de síntesis proteica. Cada sub-unidad está formada por dos moléculas muy grandes de ARN (llamado ARN ribosómico) y algunas proteínas más pequeñas. Entonces:

El proceso es el siguiente:

Y así hasta que llega un codón que dice que la proteína se acabó: es el codón de Stop.

Por ejemplo:

El ARN es este:

AUGGCCAACGGCAUGCCUACUUAA
AUG indica que tiene que empezar a ensamblar la proteína; es un "Comenzar".
GCC es Alanina. Coge Alanina (un aminoácido) y lo sujeta.
AAC es Arginina, lo pone al lado de la Alanina.
GGC es Glicina, lo ensambla al lado de la Arginina.
AUG era el símbolo de COMENZAR, pero ya ha comenzado; así que lo interpreta como Metionina. Pone el aminoácido Metionina ensamblado con la Glicina.
CCU es Prolina. Ensambla la Prolina a la Metionina.
ACU es Serina. Ensambla la serina con la Prolina.
UAA es STOP. Deja de ensamblar la proteína.

Y la proteína ensamblada es: Alanina-Argirina-Glicina-Metionina-Prolina-

Serina. (URL: http://es.wikipedia.org/wiki/Ribosoma)

El ARN de transferencia 2,9

El ARN de transferencia o ARNt es un tipo de ácido ribonucleico, encargado de transportar los aminoácidos a los ribosomas para incorporarlos a las proteínas, durante el proceso de síntesis proteica. Los ARNt reconocen los ARNm y transfieren un aminoácido determinado a la cadena de proteína que se está sintetizando. Según la información del ARNm, los ARNt sitúan los distintos aminoácidos en el lugar adecuado para sintetizar una cadena polipeptídica.

Un ARNt está formado por entre 73 y 90 nucleótidos, con un peso molecular de unos 25000 dalton, siendo el ácido ribonucleico más pequeño o de cadena más corta, pero que representa el 45% del total de ARN que existe en la célula. Se encuentra disuelto en el citoplasma celular. Pueden presentar nucleótidos poco comunes como ácido pseudouridílico, ácido inosílico e incluso bases características del ADN como la timina.

La molécula de ARNt se pliega sobre sí misma formando 5 regiones de unión tipo pares de bases y 4 asas sin unión de sus pares de bases, con una zona con pares de bases desparejada, donde pueden unirse, como si fuera una cola, los aminoácidos. En el asa II hay un codón (triplete de 3 nucleótidos) llamado anticodón que va a unirse a un codón específico del ARNm. Cada molécula de ARNt va a conseguir de esta forma la adición de un aminoácido a una proteína.

Existen unos 60 ARNt, tantos como capaces de unirse a cada aminoácido, con la particularidad de que cada ARNt reconoce un solo aminoácido. Otra característica de los ARNt es que además de las cuatro bases fundamentales presentan otras bases púricas y pirimidínicas menos frecuentes. Las enzimas conocidas como aminoacil-ARNt sintetasas catalizan la unión de cada aminoácido a su molécula de ARNt específica.

Veamos un ejemplo de la síntesis proteica. La leucina en ARNm se codifica como: CUA. El ARN de transferencia de la leucina, tiene en uno de sus extremos el complementario a CUA que es GAU. En el otro extremo se une la leucina.

Se debe recordar que G siempre se une a C y viceversa y que la U siempre se una a la A.

El triplete, por ejemplo CUA, en ARNm se llama codón. El triplete complementario, en ARNt, se llama anticodón.

El ARNt se encarga se suministrar los aminoácidos al ribosoma para que éste realice el ensamblaje de la proteína. Una vez que el ribosoma ha utilizado el aminoácido que estaba pegado al ARNt, éste se separa del ribosoma y se desplaza por el citoplasma para buscar nuevos aminoácidos. En el ejemplo, el ARNt de leucina, suministra la leucina al ribosoma y cuando se queda sin él, se separa y va a buscar otra leucina. Cuando encuentra el aminoácido leucina, se une a él y queda nuevamente preparado para suministrarlo al ribosoma cuando éste lo necesite.

En resumen:

El código genético2

En los primeros años de la década de los 60, se descifró el código genético, es decir, la clave que permitía pasar la información del ADN al ARN y luego a las proteínas. La clave es la siguiente, cada grupo de tres nucleótidos adyacentes codifican a un aminoácido, estos tripletes de nucleótidos reciben el nombre de codón. Siguiendo con la analogía del lenguaje, puede decirse que la información genética se escribe en palabras de tres letras consecutivas que no están separadas por signos de puntuación. Los 4 nucleótidos que forman el ADN o el ARN si se leen de tres en tres (triplete o codón) pueden especificar hasta 4³=64 aminoácidos distintos y en cambio en las proteínas sólo se encuentran 20 aminoácidos diferentes.

Cuando se descifró el código genético, se descubrió que varios tripletes pueden especificar un mismo aminoácido y que algunos tripletes no representan ningún aminoácido (UAG, UAA, UGA). Estos últimos tripletes que no representan ningún aminoácido se llaman tripletes sin sentido o de "terminación" (codón stop) y actúan como señales para indicar que se ha llegado al final de la síntesis de la cadena de proteína. Otro triplete interesante es el AUG que lleva la información para el aminoácido metionina. Este triplete se caracteriza por poder ser también una señal de inicio de la síntesis de la proteína, de manera que todas las proteínas cuando se fabrican tienen como aminoácido inicial una metionina.

El código genético se caracteriza por ser universal, es decir, la equivalencia entre tripletes de nucleótidos y aminoácidos la usan todos los organismos conocidos desde las bacterias a los mamíferos, entre ellos, el hombre. La universalidad del código genético permite, por ejemplo, que si se introduce un gen humano en una bacteria ésta pueda interpretar la información almacenada en dicho gen y que fabrique la misma proteína que fabricaría una célula humana.

Es esta unidad bioquímica de los seres vivos lo que ha facilitado el desarrollo de la biotecnología moderna, que utiliza ciertos microorganismos como si fueran minifactorías para replicar los ácidos nucleicos que nos interesen e incluso que produzcan proteínas humanas. (El ADN como soporte de la información genética. URL:
http://biotec.amgen.es/cgi-bin/wdbcgi.exe/amgen/pak_biotec.muestradoc?p_item=7)

Los cromosomas 10

Cromosoma es el nombre de los pequeños cuerpos en forma de bastoncillos en asa en que se divide la cromatina del núcleo celular en la mitosis, cada uno de los cuales se divide longitudinalmente, para dar origen a dos asas gemelas iguales. Su número es constante para una especie determinada -en el hombre, 46; de ellos 44 autosómicos, y 2 sexuales.

En 1842, Karl Wilhelm von Nägeli descubrió los cromosomas. En 1910, Thomas Hunt Morgan describió a los cromosomas como los portadores de los genes.

Los genes 11

El cuerpo humano está formado por 10 billones de células. Todos los organismos están compuestos de una o más células. Ella es la unidad elemental morfológica y funcional de los seres vivos (figura 2). La célula es la unidad básica de la vida. Cada célula posee una zona llamada núcleo donde se almacena la información genética, que garantiza su reproducción y los procesos de creación de proteínas. En el núcleo de cada célula, existen 46 cromosomas agrupados en 23 pares. En cada cromosoma, existe un número determinado de genes. Cada gen es la "receta" para una proteína.

 

Fig. 2. Estructura de la célula.

Un gen es una secuencia lineal de nucleótidos de ADN o ARN -un fragmento de la cadena total- que es esencial para una función específica, que puede ser el desarrollo o el mantenimiento de una función fisiológica normal. La distribución de las bases nucleótidas diferencia unos genes de otros.

Los genes se localizan en los cromosomas del núcleo celular y se disponen en línea a lo largo de cada uno de los cromosomas. Cada gen ocupa en el cromosoma, una posición determinada llamada locus.

Se considera como la unidad de almacenamiento de información y unidad de herencia porque transmite esa información a la descendencia. La realización de esta función no requiere de la traducción del gen ni tan siquiera su transcripción.

El conjunto de genes de una especie se denomina genoma.

El genoma humano, según los cálculos más recientes, contiene entre 20 000 y 25 000 genes.

Ahora bien, todos los genes no se encuentran activos al mismo tiempo. La serie de genes que están "encendidos" en un momento específico es sumamente importante. El medio ambiente variado en el que vivimos determina que diferentes genes tienen que "encenderse" en tiempos diferentes. Por ejemplo, si una comida contiene grandes cantidades de lactosa, un azúcar propia de la leche, entonces nuestro cuerpo responde activando (transcribiendo) los genes que llevan a la producción de las enzimas que descomponen la lactosa. Si un azúcar o nutriente diferente está presente, los genes adecuados se encienden para poder procesarlos.

Referencias bibliográficas

  1. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/ADN [Consultado: 20 de septiembre del 2004].
  2. Amgen. El ADN como soporte de la información genética. Disponible en:
    http://biotec.amgen.es/cgi-bin/wdbcgi.exe/amgen/pak_biotec.muestradoc?p_item=7
    [Consultado: 28 de septiembre del 2004].
  3. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/ARN [Consultado: 20 de septiembre del 2004].
  4. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/Prote%C3%B3mica [Consultado: 15 de septiembre del 2004].
  5. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/Amino%C3%A1cido [Consultado: 28 de septiembre del 2004].
  6. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/ARN_mensajero [Consultado: 4 de octubre del 2004].
  7. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/S%C3%ADntesis_proteica [Consultado: 5 de octubre del 2004].
  8. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/Ribosoma [Consultado: 7 de octubre del 2004].
  9. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/ARN_de_transferencia [Consultado: 8 de octubre del 2004].
  10. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/Cromosoma [Consultado: 17 de septiembre del 2004].
  11. Wikipedia [en línea]. Disponible en: http://es.wikipedia.org/wiki/Gen [Consultado: 21 de septiembre del 2004].

     

Recibido: 16 de diciembre del 2004.
Aprobado: 8 de enero del 2004.

Lic. Rubén Cañedo Andalia
Red Telemática de Salud en Cuba (Infomed).
Centro Nacional de Información de Ciencias Médicas.
Calle 27 No. 110 entre N y M, El Vedado.
C P 10 400, Ciudad de La Habana, Cuba.
Correo electrónico: ruben@infomed.sld.cu

1 Licenciado en Información Científico-Técnica y Bibliotecología. Red Telemática de Salud en Cuba (Infomed) Centro Nacional de Información de Ciencias Médicas.

2 Doctor en Medicina. Especialista de Primer Grado en Medicina del Trabajo. Profesor Asistente de Higiene y Epidemiología. Facultad de Ciencias Médicas "Mariana Grajales Coello", Holguín.

Ficha de procesamiento

Términos sugeridos para la indización

Según DeCS 1
BIOQUIMICA; GENETICA; SERVICIOS DE INFORMACION
BIOCHEMISTRY; GENETICS; INFORMATION SERVICES

Según DeCI 2
SERVICIOS DE INFORMACION
INFORMATION SERVICES

1 BIREME. Descriptores en Ciencias de la Salud (DeCS). Sao Paulo: BIREME, 2004.
Disponible en: http://decs.bvs.br/E/homepagee.htm
2 Díaz del Campo S. Propuesta de términos para la indización en Ciencias de la Información. Descriptores en Ciencias de la Información (DeCI). Disponible en: http://cis.sld.cu/E/tesauro.pdf


Indice Anterior Siguiente